lenticrisprv2 vectors Search Results


90
Promega lenticrisprv2
Lenticrisprv2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrisprv2+vectors/lenticrisprv2+vectors/pmc07492522-53-3-28
Average 90 stars, based on 1 article reviews
lenticrisprv2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Hanyin Education Consulting Inc human fxr1 2 atcttcatctagctcaatgg hanyin biotechnology n a recombinant dna plasmid lenticrisprv2 vector sanjana
Human Fxr1 2 Atcttcatctagctcaatgg Hanyin Biotechnology N A Recombinant Dna Plasmid Lenticrisprv2 Vector Sanjana, supplied by Hanyin Education Consulting Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrisprv2+vectors/pm39137727-257-47-41
Average 86 stars, based on 1 article reviews
human fxr1 2 atcttcatctagctcaatgg hanyin biotechnology n a recombinant dna plasmid lenticrisprv2 vector sanjana - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results